AllisonMay85
AllisonMay85 AllisonMay85
  • 21-12-2020
  • Mathematics
contestada

Please help me asap!!!

Please help me asap class=

Respuesta :

ChoiSungHyun
ChoiSungHyun ChoiSungHyun
  • 21-12-2020

Step-by-step explanation:

Angle y measures 90 degrees.

Answer Link

Otras preguntas

There are 36slices or pizza that will be divided between 7 people. How many slices does each person get if they split evenly
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
The Roman author Quintilian said, “Art was inspired by nature, a work of art differs from nature because an artist will transform nature into art.” Examine the
Find the percent of each number. 0.9 of 1000 =
Find the midpoint of āc
If possible, what is the value of x ? Is it possible to find a value of x so that the value of the surface area (in square inches) is equal to the value of the
In the diagram, the horizontal bars are parallel. Find x and y. ​
ricky has a bowl with 80 jellybeans in it. There are 16 red, 24 green,12 yellow,20 orange,ans 8 black jellybeans. Ricky takes one jellybean from the bowl withou
What language choices are in "soldier coming home from Afghanistan"
can someone help me on this one pls