montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Sarah is 20 years younger than her father in 5 years time she will be half of her father's age how old are Sara and her father now

Complete the sentence.When President Paul vonHindenburgdied, Hitler seized power in Germany.BismarckHamburg

geometry is annoying!!!1

How do you believe understanding personality traits contributes to more effective counseling practices?

Tres veces el cuadrado de un número positivo decrementado por dos veces el número es igual a 21. Determina el número

diagram of construction

Underline the adjectives and state their kind.1. That girl was looking for you.2. We lived in Udaipur for three years.3. The last boy in the queue is Sumit.4. T

POSTTEST: Argumentative Writing 1Read the prompt and claim below.Prompt: Many schools around the country are switching from a nine-month to ayear-round school c

Choose the meaning of the bold word.After hearing horror stories, the babysitter was relieved to find the children socompliant.(1 point)O exhaustedOobedientgene

Algebraic fraction without bracket