terrystaxservic terrystaxservic
  • 25-03-2018
  • Mathematics
contestada

A saleman commission on a $150000 sale is $3000 what percent is his commission

Respuesta :

waqaskhan15836
waqaskhan15836 waqaskhan15836
  • 22-12-2019

Answer:

percent commission = 2 %

Step-by-step explanation:

in order to fin the percentage

divide the commission amount by the total amount  and multiply the answer by 100

percentage of commission  = 3000/ 150000       x 100

                                            =  2 %  

Answer Link

Otras preguntas

Which set of numbers represents a Pythagorean Triple? A. 27, 38, 42 B. 33, 44, 55 C. 35, 38, 42 D. 68, 72, 81
What in the mining industry can often appear to be degrading to the local culture
An item on sales cost 35% of original price was $37 find sale price
DNA tacaggtacccgaacccaattta
Peyton has collected 120 aluminum cans for recycling. If 20 cans will fit in each blue plastic bag, how many bags will she need to carry all the cans?
tickets at a movie theater cost $9 for adults and $6.75 for children. Tickets sales for one movie showing totaled $1406.25. What equation models the situation?
What was one major effect of the spread of railroads throughout Great Britain during the industrial revolution
So far Carmela has collected 14 boxes of baseball coach there are 315 cards in each box Carmella estimate says she has about 3000 cards so she buys six albums t
In “The Most Dangerous Game” and “The Sniper”, Rainsford and the sniper both pursue their prey knowing if they don’t kill them, they will be killed. Compare an
What percent is equivalent to 0.250