pandaoksmallwoouu548
pandaoksmallwoouu548 pandaoksmallwoouu548
  • 24-08-2017
  • Spanish
contestada

Fill in the blank with the word that makes the most sense.

No quiero _______ la casa.

Question 5 options:

ayudar


amar


limpiar


trabajar

Respuesta :

ImpracticalJokers2
ImpracticalJokers2 ImpracticalJokers2
  • 24-08-2017
Limpiar is the answer.
Answer Link
vane30 vane30
  • 25-08-2017
Limpiar is the correct answer
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is 0+50×1-60×0+10=
Which university was the first to grant a woman a Ph.D. in America?
blank thousands equals 1800 tens
Glucose derivatives can produce a number of different molecules, including sugar acids. Below are three sugar acids. (1) Indicate which carbon has been oxidized
If someone was born with Jacob’s syndrome (XYY), in which parent and when nondisjunction happened during gamete formation?
write the complete thermochemical equation (including energy) for the combustion of hexane.
if a neuron had a mutation that prevented the production of voltage gated Na+ channels, what function would the neuron NOT be able to accomplish?
What name was given to the Allied plan to invade France?
Can you pleas help me solve this assignment?