kayla4L
kayla4L kayla4L
  • 24-04-2017
  • Mathematics
contestada

I don't know how to do this (answer pls ) number 3

I dont know how to do this answer pls number 3 class=

Respuesta :

khristalrose
khristalrose khristalrose
  • 24-04-2017
Subtract 2b by both sides which gets -b+4=-5 then subtract 4 by both sides so you get -b=-9 and divide -1 by both sides so that b=9
Answer Link
student51 student51
  • 24-04-2017
For problem number b = 3
Answer Link

Otras preguntas

Complete the second sentence so that it has a similar meaning to the first sentence. Use the word in bold if given.
What volume (in milliliters) of oxygen gas is required to react with 4.03 g of Mg at STP?
Sharp pain is transmitted through which type of nerve fibers?
What does Holden have against bald men?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how many atoms are present in 4.0 mol of sodium
only question 4 thank you
Explain the importance of spore formation for both eukaryotes and prokaryotes.
Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.
Desert animals need to concentrate urine. What structural changes in the kidney would be associated with a kidney that is exceptionally good at concentrating ur