syuen661 syuen661

22-12-2020
Mathematics

contestada

Solve the system of linear equations by substitution. Check your solution.

Solve the system of linear equations by substitution Check your solution class=

Respuesta :

tennis4567 tennis4567

22-12-2020

Answer:

Point Form:

(7, 8)

Equation Form:

x=7, y=8

Step-by-step explanation:

Solve for the first variable in one of the equations, then substitute the result into the other equation.

Answer Link

Otras preguntas

0-4+7-5×3÷9×5-4 do the sum of that mathematics...

Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal

which simple machines is NOT a wedge?

During dehydration, the body secretes ______ ADH and ________ aldosterone. less, more zero, more more , more less, less

help me please ,,,,,,,,ex 6 ,pleaseeee

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Where can the resource for this ocean type be found?

The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre

Water harvesting, the collection of rainfall and run off for future use, has been practiced for thousands of years; but in some regions where it was previously

louine bought a computer for 180$ and paid 10.80$ what percent of the cost is the sales tax? (Please help and explain)