Seudónimo Seudónimo
  • 24-11-2020
  • History
contestada

the harappan civilization was known for:

the harappan civilization was known for class=

Respuesta :

ar1518629
ar1518629 ar1518629
  • 24-11-2020

Answer:

b

Explanation:

Answer Link
janelledabney
janelledabney janelledabney
  • 24-11-2020

Answer:

it's B

It's B because the harappan civilization invented Seal and trade and invented many things which is what they are known for.

Answer Link

Otras preguntas

what is the main point being made by the cartoonist documeny E
Emily buys 4pens for £1 how much would 7 pens cost ?
ratio of 6 to 4 is equal to
ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,
How can one concentrate in studies ?
what is the solution of the following question? x^2+10x+25=12
how many branches of government are dictated in the us constitution,what are those branches??
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The role of media on reporting human rights violation
What is the layer of the earth where mantle convection occurs and on which the earth's crust rests?