kcjones91807 kcjones91807
  • 22-10-2020
  • Mathematics
contestada

Combine Like Terms 3f + 5f-7-9
8f + 16
8f-16
8f-15
- 8f-16
Other:

Respuesta :

Sheila35
Sheila35 Sheila35
  • 22-10-2020

Answer:

8f - 16

Step-by-step explanation:

3f +5f - 7 - 9

8f - 16

Answer Link

Otras preguntas

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
What is the rising action of the winter hibiscus
How did the end of WWI leave Germany open to follow a man like Adolf Hitler and the Nazi Party?
X+3(3)=7 what is the answer
Why would people misquote Martin Luther King Jr?​
tthe pave away company is installing a new walk way the installer uses 13 paving stones for every foot of walkway he needs 117 paving stones to complete the pro
if you weighed 92 pounds on earth
The theme is a story’s what
What is the texture of an igneous rock formed from magma that cooled slowly deep underground?.
What is 3 divided by 68