Seudónimo Seudónimo

22-10-2020
History

contestada

Does someone know this plz.

Does someone know this plz class=

Respuesta :

maryannwaweru8861 maryannwaweru8861

22-10-2020

Answer:

the answer is concentration

Answer Link

Аноним Аноним

22-10-2020

Answer:

confidence

Explanation:

cuz if you promised but it self harm then you break their confidence by telling a trusted person who can help!

Answer Link

Otras preguntas

Formulate a hypothesis based on something recently observed. And How could this hypothesis be tested?

how many molecules are in 18 grams of water

Jade recorded how many characters she used in each of her 9 most recent text messages. Here's a histogram showing her data: # of messages 2 0 0 20 40 60 80 100

7. A cargo train covers 375 km in 15 hours. Find: b) time taken to travel 770 km.

My midterm in Spanish i have 32 questions and im on 11

Which of the following statements correctly uses the distributive property? -2(15 - 3) = -2(15) + (-2)(3) 7(9 - 8) = 7(9) - 8 9(-7 + 6) = 9(-7) + 9(6) -3(12 + 5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Complete the text with the verbs in the box. There is one extra word you do not need. There is an example at the beginning (0). do fall feel get go make play s

Help me plzzzzz Speaking in 2 min Describe something you can do to help protect the environment

45. What is the wovelength of a 30. Hertz periodic wave moving ol 60. meters per second? a. 0.50m c. m b 20m d 1800 m