tanessajohnson06
tanessajohnson06 tanessajohnson06
  • 22-09-2020
  • English
contestada

who is the protagonist

Respuesta :

aryadtonnes
aryadtonnes aryadtonnes
  • 22-09-2020

Answer:

The protagonist is usually the "good guy," or the character that drives the plot of the story.

Answer Link

Otras preguntas

Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input
Which department did the US government create immediately after the 9/11 terrorist attacks
how to solve these question?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,
The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more
what is 0+50×1-60×0+10=
which branch of central government makes/enact/ passes laws
how to find the average range of cells A1:A10
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening