adrienne21 adrienne21
  • 24-08-2020
  • Geography
contestada

Which president authorized the creation of the NPS?

Respuesta :

lavs lavs
  • 24-08-2020

Answer:

PRESIDENT WOODROW WILSON

Answer Link

Otras preguntas

how did Thomas Edison contribute to the Industrial Revolution
I need help with this quickly please
find the quotient of 3870 and 18
How can one concentrate in studies ?
Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What is a vestigial organ
how much heat in kj is released by burning 9.5 grams of methane?
List and describe 3 molecular methods used to analyze DNA in a laboratory.
I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo