helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Why does Red transfer all its momentum to Green?
The environmental protection agency has been the environments watchdog for close to
a ecosystem is ______ if it can continue to function over long periods of time
Find the seventh term of the expansion of
Nina thought of a number. She called her number y. She added 14 to her number, divided the result by 6, and she got 12. What was y equal to?
A cereal manufacturer packages breakfast cereal in individual - sized boxes measuring 2 inches by 3 inches by 4 inches. The same product is also packaged in
one way your family can be a positive influence on your mental and emotional health is by helping you
What aspect of Washington's location does the peace Arch monument stand for?
x = v xo t. x = (10.0 m/s)(3.53 s) x = ????
The ozone layer protects living things on earth from A.visible light B. Infrared rays C. Ultraviolet radiation D. Carbon dioxide