jkbholbrook7690 jkbholbrook7690

22-02-2019
Arts

contestada

Since people developed writing systems, artists documented histories and beliefs in artistic documents

Respuesta :

maddie2006 maddie2006

25-02-2019

By using ink, they always used ink to write.

Answer Link

Otras preguntas

if a rectangle is quadrilateral with four right angles then what is the sum of its interior angles?

What Roman concept also contributed to Enlightment thinking?

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

What is the missing term, x, in the pattern? –2, x, –50, 250, –1250 Urgent!!

How do these excerpts from Dr. Tyson's interview and the preface differ?

The sum of the series 5(1/2)^i is x/1024 Then x =

The “mountain men” of the Oregon Territory were _____. a. ranchers b. fishermen c. trappers d. miners

Eloise scored a total of 268 points during the basketball season. Of her total points, L points came from left-handed shots. She scored 225 points with right-ha

How does the poem’s use of language and free verse contribute to the author’s purpose? of the poem Mother To Son - by Langston Hughes

The somatosensory cortex in the human brain processes information about _____. facial recognition body sensations voluntary movement spatial dimensions