JRonHWHlp JRonHWHlp

23-09-2018
Mathematics

contestada

the following equation is solve for x.3( x + 5 )- 5 /5 = 20

the following equation is solve for x3 x 5 5 5 20 class=

Respuesta :

cmoreno511 cmoreno511

23-09-2018

Your x will be 30 see image below

Ver imagen cmoreno511

Answer Link

Otras preguntas

according to welsh legend, this giant had too much to drink and forgot to close the kingdom's flood gates, thus allowing the sea to drown the land of cantre'r g

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

pyruvate enzyme that slows down the kreb cycle how does this affect the production of nadph in glycolysis and the kreb cycle ap biology

If you flip three coins, the probability of getting three heads is 0.125. Which of the following statements follows from this? answer choices O If you flip thre

a cheetah wants to eat an antelope. the cheetah can run about 25m/s the antelope can run about 20m/s. the cheetah can sustain its speed for 500m. the antelope c

3. a client diagnosed with major depression spends most of the day lying in bed the sheets pulled over his head which approach by the nurse is most therapeutic:

the person that helps identify opportunities for improvements and designs an information system to implement those opportunities is called a(n) .

For a certain oscillator the net force on the body with mass m is given by fx = -cx^3. One-quarter of a period is the time for the body to move from x=0 to x=A.

True or False: the book argues that internalizing externalities is a relatively easy task for most modern societies

During 2021, Barry (who is single and has no children) earned a salary of $13,100. He is age 30. His earned income credit for the year is: a. $323. b. $1,274. c