juliamsalas juliamsalas

22-09-2018
Mathematics

contestada

If one card is drawn from a standard 52 card playing deck, derermine the probability of getting a ten, a king or a diamind.

Respuesta :

Bouftou Bouftou

22-09-2018

21/52 is the answer
(4 tens + 4 kings + 13 diamonds)/52 (Simple logic-based or expression)

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Perpendicular lines intersect to form __________________ angles

Why wood suitable to build boats and rafts

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha

Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e

Which of the following is a potential response by a plant host to a parasite? increased production of lymphocytes allelopathy more rapid growth of tissues forma

Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this

why did the united states fail to join the league of nations

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why