hreno2002 hreno2002

22-01-2024
Spanish

contestada

Todos ____ (comer) el arroz con pollo, la especialidad de la casa.

Respuesta :

Otras preguntas

What other words in the selection connect to the concepts of decay and destruction? Edgar Allen Poe

explain the different types of food and their locality

3. Pea plant clones are given different amounts of water for a three-week period. The first pea plant receives 400 milliliters a day. The second pea plant recei

Three adults and two children go to watch a movie. Altogether, how much do their tickets cost? Cinema tickets: Adult: £9.80 each Children: £7.50 each

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Divide and verify the result 103- 112 + 19a + 10 by 5a+2

100 points will be awarded and i will reward you if correct 3. In Chapter 33, an old friend of Huck enters the scene, and the novel takes a considerable shift i

If a student stands 15 m away directly west of a tree, what is the tree's bearing from the student? A. 030° B. 045° C. 090° D. 270°

In 1995, a working group of French chief executive officers was set up by the Confederation of French Industry (CNPF) and the French Association of Private Comp

What are some topics I can talk about that relates to tuition should be free in colleges