This is the pre-mRNA of a mammalian gene. Mark the splice sites, and underline the sequence of the mature mRNA. Assume that the 5' splice site is AG/GUAAGU and that the 3' splice site is AGGN. Use / to mark the 5'splice site(s) and to mark the 3' splice site(s). There may be more than one 5’ site and 3’ site. N means any nucleotide. (In this problem, there are no branch point A’s, polyY tracts or alternate splice sites. Problem from Voet, Voet & Pratt, Fundamentals of Biochemistry, 1999) Answer Format PLEASE MARK THE SPLICE SITES AS DEFINED ABOVE WITH THESE MARKS: 5'=/ and 3'=. UNDERLINE THE MATURE mRNA SEQUENCE ON THE PRE-mRNA SEQUENCE BELOW. DO NOT WRITE OUT THE mRNA SEQUENCE WITHOUT THE INTRONS. Your answer should look like this: ……NNNNAG/GUAAGUNNNNNNNNNNNAGGNNNNNNN…… exon / intron exon 5’-AGCUUCGCGUAAAUCGUAGGUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAGGGCUUUGG ACCGAUAGAUGCGACCCUGGAGGUAAGUAUAGAUAAUUAAGCACAGGCAUGCAGGGAUAUCCU CCAAAUAGGUAAGUAACCUUACGGUCAAUUAAUUAGGCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAGGUAAGUCUGAU-3’

Respuesta :

Otras preguntas