Jessicabeast
Jessicabeast Jessicabeast
  • 26-09-2022
  • Mathematics
contestada

Which angles are congruent to each other?

<3 and <1
<3 and <8
<5 and <4
<4 and <1

Which angles are congruent to each other lt3 and lt1 lt3 and lt8 lt5 and lt4 lt4 and lt1 class=

Respuesta :

Otras preguntas

Is prescribing more medications than necessary for treatment an example of fraud, waste, or abuse?
Can someone help me please?? It’s due on thursday ❤️ (rotate picture if u can)
Do you agree or disagree that the greeting of "Merry Christmas" could offend those who observe other holidays?​
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Solve the equation 3x + 2 = x + 4(x +2)
WHOEVER ANSWERS RIGHT GET BRAINLiST Which text structure uses point-by-point and block organization?cause and effectproblem and solutionchronological orderorder
You wish to buy a new skateboard. To earn money, you sell your baseball cards to your friends for $2.50 each. If the new skateboard costs $98, what is the minim
The approximate average distances from the sun to Mars and Mercury are listed below: Mars: 2.28 x 108 kilometers Mercury: 5.79 x 107 kilometers How many times f
Which lines from "Dreams" by Langston Hughes contain a metaphor? A. frozen with snow B. Life is a barren field C. Hold fast to dreams
On a piece of paper, graph f(x) = 4x. Then determine which answer choice matches the graph you drew.